Curation Information

Publication: Managing oxidative stresses in Shewanella oneidensis: intertwined roles of the OxyR and OhrR regulons.;Li N, Luo Q, Jiang Y, Wu G, Gao H;Environmental microbiology 2014 Jun; 16(6):1821-34 [25009841]
TF: OhrR [Q8EI70, view regulon]
Reported TF sp.: Shewanella oneidensis MR-1
Reported site sp.: Shewanella oneidensis MR-1
Created by: Dinara Sagitova
Curation notes: Add bacterial one hybrid to the list of the techniques.

Experimental Process

qRT-PCR with mRNA from the wild-type and ohrR mutant S.oneidensis strains showed that ohr expression is repressed by OhrR in the absenses of tBOOH. Bacterial one-hybrid analysis confirmed that OhrR directly interacts with the ohr-ohrR intergenic region.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AATTAGATTGCGTGCAATCTAAAT

AATTAGATTGCGTGCAATCTAATT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
AATTAGATTGCGTGCAATCTAATT	ohrA, ohrR,		Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. -	repressor	not specified