Curation Information

Publication
Phosphorylation-dependent derepression by the response regulator HnoC in the Shewanella oneidensis nitric oxide signaling network.;Plate L, Marletta MA;Proceedings of the National Academy of Sciences of the United States of America 2013 Nov 26; 110(48):E4648-57 [24218564]
TF
HnoC [Q8EE50, view regulon]
Reported TF sp.
Shewanella oneidensis MR-1
Reported site sp.
Shewanella oneidensis MR-1
Created by
Grace Chandler
Curation notes
-

Experimental Process

DNA microarray analysis identified HnoC as a transcriptional regulator in Shewanella oneidensis, locating regulated hno-network signaling genes. GFP assays confirmed this regulation, characterizing HnoC as a repressor. EMSA demonstrated direct binding of HnoC to the hno promoter region. DNase I footprinting localized two binding sites. Multiple sequence alignment identified a consensus HnoC binding sequence.

Transcription Factor Binding Sites


GTATAGGACAAATGTGACACGTTCAT
ATCTATAAGACAAATAGGACAAATGCG
GTATAGGACAAATGTGACACGTTCAT
ATCTATAAGACAAATAGGACAAATGCG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GTATAGGACAAATGTGACACGTTCAT SO_2144,
... ... SO_2144 SO_2145
Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - repressor tetramer
ATCTATAAGACAAATAGGACAAATGCG SO_2541, SO_2540,
... ... SO_2541 SO_2540 SO_2544 SO_2543 SO_2542 SO_2538 SO_2539
Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - repressor tetramer