Curation Information

Publication
The transcription factor AmrZ utilizes multiple DNA binding modes to recognize activator and repressor sequences of Pseudomonas aeruginosa virulence genes.;Pryor EE Jr, Waligora EA, Xu B, Dellos-Nolan S, Wozniak DJ, Hollis T;PLoS pathogens 2012; 8(4):e1002648 [22511872]
TF
AmrZ [G3XCY4, view regulon]
Reported TF sp.
Pseudomonas aeruginosa FRD1
Reported site sp.
Pseudomonas aeruginosa FRD1
Created by
Erill Lab
Curation notes
-
External databases
Protein Data Bank (3QOQ) .

Experimental Process

X-ray crystallography of the AmrZ:amrZ1 complex shows that AmrZ binds as dimer of dimers and reveals base specific contacts with the actGGCaaaacGCCggca sequence. Site directed mutagenesis to the GGC elements, coupled with fluorescence anisotropy was used to verify the importance of these contacts, as well as the AT-rich spacer. Site directed mutagenesis and fluorescence anisotropy were also used to interrogate the algD binding site ATTGGCCATTACCAGCCTCC.

Transcription Factor Binding Sites


GTACTGGCAAAACGCCGGCACG
CATTGGCCATTACCAGCCTCCC
GTACTGGCAAAACGCCGGCACG
CATTGGCCATTACCAGCCTCCC

Quantitative data format: Kd b (nM)

GTACTGGCAAAACGCCGGCACG 8.41
CATTGGCCATTACCAGCCTCCC 198.0

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GTACTGGCAAAACGCCGGCACG
... ... phnC PA3383 phnE PA3381 PA3380 PA3379 PA3378 PA3377 PA3376 PA3375 PA3374 PA3373 PA3372 amrZ
Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details X-ray crystallography (ECO:0005670) - repressor tetramer
CATTGGCCATTACCAGCCTCCC
... ... algD alg8 alg44 algK algE algG algX algL
Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator tetramer