Curation Information

Publication: Dissecting the role of DNA sequence in Helicobacter pylori NikR/DNA recognition.;Evans SE, Michel SL;Dalton transactions (Cambridge, England : 2003) 2012 Jul 14; 41(26):7946-51 [22549756]
TF: NikR [O25896, view regulon]
Reported TF sp.: Helicobacter pylori
Reported site sp.: Helicobacter pylori
Created by: Matthew Coveyou
Curation notes: -

Experimental Process

Eight binding sites identified in earlier publications were aligned according to binding affinity, four weak sites and four strong sites. Systematic mutagenesis of two representative binding sites was performed and binding affinity was determined by fluorescent anisotropy. It was shown that the presence of a thymine in the third position of the second pseudo-palindrome strongly influenced whether binding affinity was strong (thymine present) or weak (thymine absent).

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TATTATAATTGTTCATTTTAAATTA
TAACACTAATTCATTTTAAATAATA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TATTATAATTGTTCATTTTAAATTA			Experimental technique details Fluorescence anisotropy (ECO:0005632) Fluorescence anisotropy - ECO:0005632 Fluorescence anisotropy can be used to measure the binding constants and kinetics of reactions that cause a change in the rotational time of the molecules. If the fluorophore is bound to a small molecule, the rate at which it tumbles can decrease significantly when it is bound tightly to a large protein. If the fluorophore is attached to the larger protein in a binding pair, the difference in polarization between bound and unbound states will be smaller (because the unbound protein will already be fairly stable and tumble slowly to begin with) and the measurement will be less accurate. The degree of binding is calculated by using the difference in anisotropy of the partially bound, free and fully bound( large excess of protein) states measured by titrating the two binding partners. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	repressor	tetramer
TAACACTAATTCATTTTAAATAATA			Experimental technique details Fluorescence anisotropy (ECO:0005632) Fluorescence anisotropy - ECO:0005632 Fluorescence anisotropy can be used to measure the binding constants and kinetics of reactions that cause a change in the rotational time of the molecules. If the fluorophore is bound to a small molecule, the rate at which it tumbles can decrease significantly when it is bound tightly to a large protein. If the fluorophore is attached to the larger protein in a binding pair, the difference in polarization between bound and unbound states will be smaller (because the unbound protein will already be fairly stable and tumble slowly to begin with) and the measurement will be less accurate. The degree of binding is calculated by using the difference in anisotropy of the partially bound, free and fully bound( large excess of protein) states measured by titrating the two binding partners. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	tetramer