Curation Information

Publication
Characterization of enhancer binding by the Vibrio cholerae flagellar regulatory protein FlrC.;Correa NE, Klose KE;Journal of bacteriology 2005 May; 187(9):3158-70 [15838043]
TF
FlrC [Q9KQ67, view regulon]
Reported TF sp.
Vibrio cholerae O395
Reported site sp.
Vibrio cholerae O395
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Primer extension analysis of the flaA promoter with RNA from wild-type and flrC, rpoN mutant V. cholerae strains determined the transcription start site of these genes. lacZ reporter assays with flaA promoter fragments of different lengths localized FlrC binding region to -54 to +66 bp relative to the TSS. EMSA confirmed that FlrC binds specifically to this promoter. DNase I footprinting localized the exact region bound by FlrC.

Transcription Factor Binding Sites


AAAGCGGCAAGTCAGCGGCAAAATGGATTGCCGCTCACCGAAA
AAAGCGGCAAGTCAGCGGCAAAATGGATTGCCGCTCACCGAAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type