Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e4e0
Genome
Pectobacterium carotovorum - NC_018525.1
TF
RdgB [UniProtKB:Q47588, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTATTAAACTCGATTAATAAGC + [1604142, 1604165] 9084157 Experimental technique details CAT reporter gene assays (ECO:0005617) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 1133

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PCC21_014030
Gene Locus tag Description
PCC21_014030 PCC21_014030 pectin lyase