Site information for: HrpX in species Xanthomonas euvesicatoria; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_0002e3d0
Genome: Xanthomonas euvesicatoria - NC_007508.1
TF: HrpX [UniProtKB:Q3BW17, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
TTCGCCAAAATAGTTCGTCGGCCAG	- [464991, 465015]	16936021	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. -	1127

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
hrpF	XCV0411	HrpF protein
XCV0410	XCV0410	hypothetical protein
hpaF	XCV0409	HpaF protein
hpaG	XCV0408	HpaG LRR protein
XCV0407	XCV0407	hypothetical protein
XCV0412	XCV0412	hypothetical protein
XCV0413	XCV0413	hypothetical protein
xopF1	XCV0414	outer protein F1