Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e3b0
Genome
Xanthomonas euvesicatoria - NC_007508.1
TF
HrpX [UniProtKB:Q3BW17, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCCGGACCAGCTATCGCTTCGC - [473793, 473817] 16936021 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA affinity purification (ECO:0005629) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1127

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hpaC hrcQ hrcR hrcS hpaA hrcD hrpD6 hrpE hpaB hpaE
Gene Locus tag Description
hpaC XCV0424 HpaC protein
hrcQ XCV0423 HrcQ protein
hrcR XCV0422 type III secretion system protein
hrcS XCV0421 HrcS protein
hpaA XCV0420 HpaA protein
hrcD XCV0419 HrcD protein
hrpD6 XCV0418 HrpD6 protein
hrpE XCV0417 HrpE protein
hpaB XCV0416 HpaB protein
hpaE XCV0415 HpaE protein