Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e390
Genome
Xanthomonas euvesicatoria - NC_007508.1
TF
HrpX [UniProtKB:Q3BW17, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCCAGCGAATTCCGATATTCGC + [477427, 477451] 16936021 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA affinity purification (ECO:0005629) - 1127

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hrcU hrcV hpaC hrcQ hrcR hrcS hpaA hrcD hrpD6 hrpE hpaB hpaE hrpB1 hrpB2 hrcJ hrpB4 hrcL hrcN hrpB7 hrcT hrcC
Gene Locus tag Description
hrcU XCV0426 type III secretion system protein HrcU
hrcV XCV0425 HrcV protein
hpaC XCV0424 HpaC protein
hrcQ XCV0423 HrcQ protein
hrcR XCV0422 type III secretion system protein
hrcS XCV0421 HrcS protein
hpaA XCV0420 HpaA protein
hrcD XCV0419 HrcD protein
hrpD6 XCV0418 HrpD6 protein
hrpE XCV0417 HrpE protein
hpaB XCV0416 HpaB protein
hpaE XCV0415 HpaE protein
hrpB1 XCV0427 HrpB1 protein
hrpB2 XCV0428 HrpB2 protein
hrcJ XCV0429 HrcJ protein
hrpB4 XCV0430 HrpB4 protein
hrcL XCV0431 type III secretion system protein HrpB
hrcN XCV0432 type III secretion system ATPase
hrpB7 XCV0433 HrpB7 protein
hrcT XCV0434 HrcT protein
hrcC XCV0435 HrcC protein