Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e360
Genome
Xanthomonas euvesicatoria - NC_007508.1
TF
HrpX [UniProtKB:Q3BW17, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGGCCAAGCTTACGTCAACTCGC + [3895037, 3895061] 16936021 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 1127

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XCV3407
Gene Locus tag Description
XCV3407 XCV3407 hypothetical protein