Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e340
Genome
Xanthomonas euvesicatoria - NC_007508.1
TF
HrpX [UniProtKB:Q3BW17, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCACACGCACCCTTGCATTCGC + [2894866, 2894890] 16936021 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 1127

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XCV2568 XCV2567 XCV2566 XCV2565
Gene Locus tag Description
XCV2568 XCV2568 hypothetical protein
XCV2567 XCV2567 hypothetical protein
XCV2566 XCV2566 metallo-beta-lactamase superfamily protein
XCV2565 XCV2565 hypothetical protein