Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002e330
Genome
Xanthomonas euvesicatoria - NC_007508.1
TF
HrpX [UniProtKB:Q3BW17, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCGGCGCGCGCGCCAGCTTCGT + [600441, 600465] 16936021 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 1127

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XCV0536 XCV0535
Gene Locus tag Description
XCV0536 XCV0536 lipase
XCV0535 XCV0535 hypothetical protein