Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
TTCGCGGCGCGCGCGCCAGCTTCGT | + [600441, 600465] | 16936021 |
|
1127 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.