Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002df30
Genome
Thermus thermophilus - NC_006461.1
TF
CsoR [UniProtKB:Q5SHL1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACCCCACCCCACCTGGGGTGGGGTA + [1614377, 1614402] 20395270 Experimental technique details DNA affinity purification (ECO:0005629) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Visual sequence inspection (nan) - 1118

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... TTHA1718 TTHA1719 TTHA1720 TTHA1721 TTHA1722 TTHA1723 TTHA1724 TTHA1726 TTHA1727 TTHA1728
Gene Locus tag Description
TTHA1718 TTHA1718 heavy metal binding protein
TTHA1719 TTHA1719 copper homeostasis operon regulatory protein
TTHA1720 TTHA1720 cation-transporting ATPase
TTHA1721 TTHA1721 hypothetical protein
TTHA1722 TTHA1722 response regulator
TTHA1723 TTHA1723 sensor histidine kinase
TTHA1724 TTHA1724
TTHA1726 TTHA1726 S-layer repressor
TTHA1727 TTHA1727 hypothetical protein
TTHA1728 TTHA1728 hypothetical protein