Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
TTCGCGTGCATGACCACGATTTCG | - [1107555, 1107578] | 15060033 |
|
1113 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
RS_RS21330 | RS_RS21330 | protein PopA1 |
RS_RS21325 | RS_RS21325 | protein PopB |
RS_RS21320 | RS_RS21320 | protein PopC |