Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002de70
Genome
Ralstonia solanacearum - NC_003296.1
TF
HrpB [UniProtKB:P31778, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCGTGCATGACCACGATTTCG - [1107555, 1107578] 15060033 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 1113

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... RS_RS21330 RS_RS21325 RS_RS21320
Gene Locus tag Description
RS_RS21330 RS_RS21330 protein PopA1
RS_RS21325 RS_RS21325 protein PopB
RS_RS21320 RS_RS21320 protein PopC