Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dde0
Genome
Helicobacter pylori - NC_000915.1
TF
NikR [UniProtKB:O25896, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CATTATTAAGTTTTTTTTGTTTTTA + [1461319, 1461343] 19119856 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Fluorescence anisotropy (ECO:0005632) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 1111

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HP1400
Gene Locus tag Description
HP1400 HP1400 iron(III) dicitrate transport protein FecA