Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dd10
Genome
Helicobacter mustelae - NC_013949.1
TF
NikR [UniProtKB:D3UIX2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATATTGCATCGCAAAAAATATTA + [359394, 359418] 19894125 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 1107

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HMU03020 HMU03030
Gene Locus tag Description
HMU03020 HMU03020 TonB-dependent receptor protein
HMU03030 HMU03030 iron(III) ABC transporter periplasmic iron-binding protein CeuE