Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dce0
Genome
Helicobacter mustelae - NC_013949.1
TF
NikR [UniProtKB:D3UIX2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTATTTATAAATTTTTCTTGATA + [364669, 364693] 19894125 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 1107

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ureB ureA tuf HMU_t10 HMU_t09 HMU_t08 HMU_t07 ureH ureG ureF ureE ureI HMU03040
Gene Locus tag Description
ureB HMU03060 urease subunit alpha
ureA HMU03050 urease subunits beta and gamma
tuf HMU03120 elongation factor TU
HMU_t10 HMU_t10 tRNA
HMU_t09 HMU_t09 tRNA
HMU_t08 HMU_t08 tRNA
HMU_t07 HMU_t07 tRNA
ureH HMU03110 urease accessory protein UreH
ureG HMU03100 urease accessory protein UreG
ureF HMU03090 urease accessory protein UreF
ureE HMU03080 urease accesory protein UreE
ureI HMU03070 Urease accessory protein UreI
HMU03040 HMU03040 galactosyltransferase