Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002dcd0
Genome
Helicobacter pylori - NC_000915.1
TF
NikR [UniProtKB:O25896, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAACACTAATTCATTTTAAATAATA - [78072, 78096] 17522054 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details Premethylation interference footprinting (ECO:0005656) - 1106

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ureB HP0073
Gene Locus tag Description
ureB HP0072 urease subunit beta
HP0073 HP0073 urease subunit alpha