Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d950
Genome
Streptococcus pyogenes - NC_006086.1
TF
CovR [UniProtKB:Q1J8D4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAACTTTATTTTTAAAATAAGGTTAAAAATAAACGACTCGTGTTCTTATCAGTTACTTATTAGATAAGGAGGTAAACCTTATG + [575503, 575585] 16174772 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - 1091

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... M6_Spy0578 M6_Spy0579 M6_Spy0580 M6_Spy0581 M6_Spy0582 M6_Spy0583 M6_Spy0584 M6_Spy0585 M6_Spy0586
Gene Locus tag Description
M6_Spy0578 M6_Spy0578 streptolysin S precursor
M6_Spy0579 M6_Spy0579 streptolysin S biosynthesis protein
M6_Spy0580 M6_Spy0580 streptolysin S biosynthesis protein
M6_Spy0581 M6_Spy0581 streptolysin S biosynthesis protein
M6_Spy0582 M6_Spy0582 SagE
M6_Spy0583 M6_Spy0583 SagF
M6_Spy0584 M6_Spy0584 SagG
M6_Spy0585 M6_Spy0585 SagH
M6_Spy0586 M6_Spy0586 SagI