Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d8d0
Genome
Streptococcus agalactiae - NC_007432.1
TF
CovR [UniProtKB:I6L8Z5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACATAATAATGATATTTTAATTAGAGTGTGAATTTATAATTAA + [727539, 727582] 19170889 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1087

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cylX cylD cylG SAK_0793 cylZ cylA cylB cylE cylF cylI cylJ cylK
Gene Locus tag Description
cylX SAK_0790 cylX protein
cylD SAK_0791 CylD protein
cylG SAK_0792 cylG protein
SAK_0793 SAK_0793 acyl carrier protein
cylZ SAK_0794 cylZ protein
cylA SAK_0795 ABC transporter ATP-binding protein
cylB SAK_0796 ABC transporter permease
cylE SAK_0797 CylE protein
cylF SAK_0798 cylF protein
cylI SAK_0799 cylI protein
cylJ SAK_0800 CylJ protein
cylK SAK_0801 CylK protein