Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d7f0
Genome
Corynebacterium glutamicum - NC_009342.1
TF
Zur [UniProtKB:Q8NNC4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGTTGACAGCTGTTTTCAATA + [2800983, 2801003] 23061624 Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - 1081

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... cgR_2534 cgR_2535 cgR_2536 cgR_2537
Gene Locus tag Description
cgR_2534 cgR_2534 hypothetical protein
cgR_2535 cgR_2535 hypothetical protein
cgR_2536 cgR_2536 hypothetical protein
cgR_2537 cgR_2537 hypothetical protein