Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d7b0
Genome
Streptomyces coelicolor - NC_003888.3
TF
Zur [UniProtKB:Q9L2H5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGACAACGGTTTCCATATTTGTTGAAAATGAGTGTCATGAACGTACG + [2703967, 2704014] 17400736 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details S1 nuclease protection (ECO:0005666) - Experimental technique details Visual sequence inspection (nan) - 1079

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SCO2505 SCO2506 SCO2507 SCO2504 SCO2508
Gene Locus tag Description
SCO2505 SCO2505 ABC-transporter metal-binding lipoprotein
SCO2506 SCO2506 metal transport ABC transporter
SCO2507 SCO2507 metal transport ABC transporter
SCO2504 SCO2504 glycyl-tRNA synthetase
SCO2508 SCO2508 metal uptake regulation protein