Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d790
Genome
Streptomyces coelicolor - NC_003888.3
TF
Zur [UniProtKB:Q9L2H5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATCTTACTGAAAATGAATTCCATTAACAGCTAGG + [3791109, 3791143] 17400736 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details S1 nuclease protection (ECO:0005666) - Experimental technique details Visual sequence inspection (nan) - 1079

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rpmG rpmE2 SCO3426 SCO3425 rpmB rpsN SCO3431
Gene Locus tag Description
rpmG SCO3428 50S ribosomal protein L33
rpmE2 SCO3427 50S ribosomal protein L31
SCO3426 SCO3426 hypothetical protein
SCO3425 SCO3425 30S ribosomal protein S18
rpmB SCO3429 50S ribosomal protein L28
rpsN SCO3430 30S ribosomal protein S14
SCO3431 SCO3431 hypothetical protein