Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002d630
Genome
Dickeya dadantii - NC_014500.1
TF
Fur [UniProtKB:D2BRN2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTAATAAAAACCATTGTCA + [3575336, 3575355] 12423024 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 1071

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pelE
Gene Locus tag Description
pelE Dda3937_03371 pectate lyase pelE