Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c9b0
Genome
Caulobacter vibrioides - NC_011916.1
TF
OxyR [UniProtKB:A0A0H3CCL0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCGGCCACGGAATGGTTTCCTCTATCCATCCGATAAGAACAATCAATTTTA + [3285913, 3285963] 21257767 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 1019

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... katG
Gene Locus tag Description
katG CCNA_03138 peroxidase/catalase katG