Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c330
Genome
Escherichia coli - NC_000913.3
TF
NikR [UniProtKB:P0A6Z6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTATGACGAATACTTAAAATCGTCATAC + [3613602, 3613629] 10787413 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Premethylation interference footprinting (ECO:0005656) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 1013

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... nikD nikC nikB nikA nikE nikR
Gene Locus tag Description
nikD b3479 nickel transporter subunit
nikC b3478 nickel transporter subunit
nikB b3477 nickel transporter subunit
nikA b3476 nickel-binding, heme-binding periplasmic protein
nikE b3480 nickel transporter subunit
nikR b3481 DNA-binding transcriptional repressor, Ni-binding