Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c090
Genome
Sinorhizobium meliloti - NC_020560.1
TF
WggR (ExpG) [UniProtKB:P96440, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAAATTACTTTAAAATTTGAAG - [980467, 980488] 18344362 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - 1001

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... wgeA
Gene Locus tag Description
wgeA SM2011_b21314 RTX toxins and related Ca2+-binding proteins