Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c080
Genome
Sinorhizobium meliloti - NC_020560.1
TF
WggR (ExpG) [UniProtKB:P96440, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATATTGCTTCAATTTTTGAAG + [985879, 985900] 18344362 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - 1001

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... wgaA wgaB wgcA
Gene Locus tag Description
wgaA SM2011_b21319 Putative membrane protein WgaA (formerly ExpA1)
wgaB SM2011_b21320 Putative bifunctional glycosyltransferase,forming beta-glycosyl and alpha-glycosyl linkages protein WgaB (formerly ExpA23)
wgcA SM2011_b21318 Putative glycosyltransferase,forming alpha-glycosyl linkages protein WgcA (formerly ExpC)