Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c070
Genome
Sinorhizobium meliloti - NC_003037.1
TF
NodD1 [UniProtKB:P03031, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACAATCGATTTTACCAATCCCACT + [469407, 469432] 16855231 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 1000

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... nodF nodE nodH SMa0850
Gene Locus tag Description
nodF SMa0852 acyl carrier protein
nodE SMa0853 3-ketoacyl-ACP synthase
nodH SMa0851 NodH sulfotransferase
SMa0850 SMa0850 hypothetical protein