Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002c040
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ChvI [UniProtKB:P50350, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGCGTGCCTTTTTTTCGCCACAA + [2517327, 2517349] 19749054 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GUS reporter gene assay (ECO:0005641) - 998

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc01580 aatA SMc01581 SMc01583
Gene Locus tag Description
SMc01580 SMc01580 hypothetical protein
aatA SMc01578 aspartate aminotransferase
SMc01581 SMc01581 hypothetical protein
SMc01583 SMc01583 hypothetical protein