Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002be90
Genome
Sinorhizobium meliloti - NC_017325.1
TF
Rem [UniProtKB:F7X8H2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTGCCGCTTGCATCGCGCTTT + [321427, 321448] 16980496 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 991

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SM11_chr0312 motB motC fliK SM11_chr0316
Gene Locus tag Description
SM11_chr0312 SM11_chr0312 hypothetical protein
motB SM11_chr0313 Flagellar motor protein
motC SM11_chr0314 chemotaxis protein
fliK SM11_chr0315 FliK hook length control protein
SM11_chr0316 SM11_chr0316 hypothetical protein