Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002be80
Genome
Sinorhizobium meliloti - NC_017325.1
TF
Rem [UniProtKB:F7X8H2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCCTTCGCCAAGTTCGCGCAAGTTT + [294146, 294170] 16980496 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 991

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... fliF
Gene Locus tag Description
fliF SM11_chr0282 flagellar MS-ring protein