Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002be40
Genome
Vibrio cholerae - NC_002506.1
TF
CRP [UniProtKB:Q9KNW6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACGAGATTTACATCAACTTA + [994622, 994643] 24215877 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - 990

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCA1045 VCA1046 mtlR VCA1044 VCA1043 VCA1042 VCA1048
Gene Locus tag Description
VCA1045 VCA1045 PTS system mannitol-specific transporter subunit IIABC
VCA1046 VCA1046 mannitol-1-phosphate 5-dehydrogenase
mtlR VCA1047 mannitol repressor protein
VCA1044 VCA1044 hypothetical protein
VCA1043 VCA1043 tagE protein
VCA1042 VCA1042 Ccm2-like protein
VCA1048 VCA1048 Gfo/Idh/MocA family oxidoreductase