Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b3c0
Genome
Yersinia pseudotuberculosis - NC_010465.1
TF
RovM [UniProtKB:Q0WF12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCGTTGATACATCATTTTTTCTAAAGAATTGCT + [2082228, 2082261] 17074075 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 975

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... YPK_1876
Gene Locus tag Description
YPK_1876 YPK_1876 transcriptional regulator SlyA