Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b1e0
Genome
Xylella fastidiosa - NC_002488.3
TF
BigR [UniProtKB:Q9PFB1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATATATATTATTATATATTG - [720560, 720580] 17586627 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 965

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XF0768 XF0767 XF0766 XF0765 XF0764
Gene Locus tag Description
XF0768 XF0768 hypothetical protein
XF0767 XF0767 ArsR family transcriptional regulator
XF0766 XF0766 hypothetical protein
XF0765 XF0765 hypothetical protein
XF0764 XF0764 hypothetical protein