Site information for: OryR in species Xanthomonas oryzae; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_0002b0c0
Genome: Xanthomonas oryzae - NC_006834.1
TF: OryR [UniProtKB:Q5H3E9, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
ACCTGTGAGATTTGCCAGTT	+ [1300122, 1300141]	19028884	Experimental technique details GUS reporter gene assay (ECO:0005641) GUS reporter gene assay - ECO:0005641 This is a reporter assay technique, used typically to measure expression of a target gene. A promoter of interest is investigated by fusioning it with the reporter gene, which is then monitored. In GUS, the reporter is the β-glucuronidase enzyme from Escherichia coli, capable of transforming non-fluorescent substates into fluorescent, thereby allowing detection. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	959

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
XOO1269	XOO1269	proline imino-peptidase