Binding site | Location | Publication | Experimental techniques used | Curation |
---|---|---|---|---|
ACCTCATGACGCTGGCAACA | + [2778256, 2778275] | 23083431 |
|
958 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Gene | Locus tag | Description |
---|---|---|
flhF | XOO2619 | flagellar biosynthesis regulator FlhF |
fleN | XOO2620 | flagellar biosynthesis switch protein |
fliA | XOO2621 | RNA polymerase sigma factor FliA |
cheY | XOO2622 | chemotaxis protein |
cheZ | XOO2623 | chemotaxis related protein |
cheA | XOO2624 | chemotaxis related protein |
XOO2625 | XOO2625 | IS1478 transposase |
tnpA | XOO2626 | transposase |
XOO2627 | XOO2627 | IS30 family transposase |