Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002b0b0
Genome
Xanthomonas oryzae - NC_006834.1
TF
OryR [UniProtKB:Q5H3E9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTCATGACGCTGGCAACA + [2778256, 2778275] 23083431 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Visual sequence inspection (nan) - 958

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... flhF fleN fliA cheY cheZ cheA XOO2625 tnpA XOO2627
Gene Locus tag Description
flhF XOO2619 flagellar biosynthesis regulator FlhF
fleN XOO2620 flagellar biosynthesis switch protein
fliA XOO2621 RNA polymerase sigma factor FliA
cheY XOO2622 chemotaxis protein
cheZ XOO2623 chemotaxis related protein
cheA XOO2624 chemotaxis related protein
XOO2625 XOO2625 IS1478 transposase
tnpA XOO2626 transposase
XOO2627 XOO2627 IS30 family transposase