Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002af90
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACAAATCTATTGGGAAAAAATGAG + [1996752, 1996775] 17384071 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 952

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc00168
Gene Locus tag Description
SMc00168 SMc00168 autoinducer synthase