Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002af30
Genome
Sinorhizobium meliloti - NC_020528.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACGGGACGCCCTGTCTTTTTG + [713927, 713948] 18842098 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - 948

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... visN
Gene Locus tag Description
visN SM2011_c03015 Transcriptional regulator of motility genes,LuxR family