Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002aef0
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGCCCCGCACTTTGACGGGG - [2087714, 2087733] 23687265 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - 946

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc04258 SMc04257 SMc04256 manB SMc04254 SMc04253
Gene Locus tag Description
SMc04258 SMc04258 ABC transporter permease
SMc04257 SMc04257 ABC transporter permease
SMc04256 SMc04256 ABC transporter ATP-binding protein
manB SMc04255 beta-mannosidase
SMc04254 SMc04254 hypothetical protein
SMc04253 SMc04253 oxidoreductase