Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002aed0
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGCCCAGCTATAAGAAGTGA - [3036105, 3036124] 23687265 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - 946

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc04032 pip2 pip3 SMc04034 SMc04035 SMc04036 SMc04037
Gene Locus tag Description
SMc04032 SMc04032 transcriptional regulator
pip2 SMc04031 proline iminopeptidase
pip3 SMc04033 proline iminopeptidase
SMc04034 SMc04034 peptide ABC transporter permease
SMc04035 SMc04035 peptide ABC transporter permease
SMc04036 SMc04036 ABC transporter ATP-binding protein
SMc04037 SMc04037 peptide ABC transporter