Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002aec0
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCCTATAAAAGATGAAGGG + [3178486, 3178505] 23687265 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - 946

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc03149 SMc03150 SMc03148 SMc03147 SMc03146 SMc03145 SMc03144
Gene Locus tag Description
SMc03149 SMc03149 hypothetical protein
SMc03150 SMc03150 transcriptional regulator
SMc03148 SMc03148 hypothetical protein
SMc03147 SMc03147 ABC transporter ATP-binding protein
SMc03146 SMc03146 transporter
SMc03145 SMc03145 hypothetical protein
SMc03144 SMc03144 hypothetical protein