Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002ae40
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCCCGGATATTCATTGAAA - [2610276, 2610295] 23687265 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - 946

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc01524 dppA2 dppB2 dppC2 dppD2 dppF2
Gene Locus tag Description
SMc01524 SMc01524 dipeptidase
dppA2 SMc01525 dipeptide binding periplasmic protein
dppB2 SMc01526 peptide ABC transporter permease
dppC2 SMc01527 peptide ABC transporter permease
dppD2 SMc01528 peptide ABC transporter ATP-binding protein
dppF2 SMc01529 peptide ABC transporter ATP-binding protein