Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002ae20
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACTCCGAGTTTTTGCAGGTT - [3568554, 3568573] 23687265 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 946

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc03899 TRm1a TRm1b SMc03896 ndvA
Gene Locus tag Description
SMc03899 SMc03899 hypothetical protein
TRm1a SMc03898 transposase ISRM1
TRm1b SMc03948 transposase ISRM1
SMc03896 SMc03896 transcriptional regulator
ndvA SMc03900 cyclic beta-1,2-glucan ABc transporter