Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0002ae10
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCCCTTAAATGGCGGGGTT - [2064419, 2064438] 23687265 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - 946

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SMc04237 SMc04238
Gene Locus tag Description
SMc04237 SMc04237 hypothetical protein
SMc04238 SMc04238 hypothetical protein