Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029c80
Genome
Sinorhizobium meliloti - NC_020528.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACCATGTTTATTATAGGGGCA + [1995632, 1995653] 19889097 Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Visual sequence inspection (nan) - 944

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... sinR
Gene Locus tag Description
sinR SM2011_c00170 Quorum sensing system,AHL autoinducer-binding,luxR family,regulator of sinI