Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029c70
Genome
Sinorhizobium meliloti - NC_003047.1
TF
ExpR [UniProtKB:Q92L12, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCCCCGCTAAATTCAGGGTA + [160627, 160646] 24509921 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 943

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pilA1 SMc04115 cpaA1 cpaB1 cpaC1 SMc04110 cpaE1 cpaF1 SMc02821 SMc02822
Gene Locus tag Description
pilA1 SMc04114 pilin subunit protein
SMc04115 SMc04115 hypothetical protein
cpaA1 SMc04113 pilus assembly transmembrane protein
cpaB1 SMc04112 pilus assembly signal peptide protein
cpaC1 SMc04111 pilus assembly transmembrane protein
SMc04110 SMc04110 hypothetical protein
cpaE1 SMc04109 response regulator protein
cpaF1 SMc02820 pilus assembly protein
SMc02821 SMc02821 hypothetical protein
SMc02822 SMc02822 hypothetical protein