Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000296e0
Genome
Vibrio cholerae - NC_012667.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTGAGCGTTTTGTGGGTAA + [740127, 740148] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 925

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_000641 VCD_000642 VCD_000640 VCD_000639 fbpC
Gene Locus tag Description
VCD_000641 VCD_000641 regulatory protein UhpC
VCD_000642 VCD_000642 sensor histidine protein kinase UhpB glucose-6-phosphate specific
VCD_000640 VCD_000640 ABC transporter of unknown compound (not Fe3+) substrate-binding protein
VCD_000639 VCD_000639 ABC transporter of unknown compound (not Fe3+) permease protein
fbpC VCD_000638 ferric transporter ATP-binding subunit