Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00029620
Genome
Vibrio cholerae - NC_012668.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAATTGATTGTAATCAGATTGT - [158176, 158197] 19276207 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details PSSM site search (ECO:0005659) - 924

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_001175 VCD_001176
Gene Locus tag Description
VCD_001175 VCD_001175 malate dehydrogenase
VCD_001176 VCD_001176 arginine repressor