Site information for: HapR in species Vibrio cholerae; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_00029390
Genome: Vibrio cholerae - NC_012668.1
TF: HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
TATTGAGAATAATGTCAGTTT	- [773427, 773447]	21926235	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details Luciferase reporter assay (ECO:0005648) Luciferase reporter assay - ECO:0005648 A type of reporter assay . The idea is identical to a betagalactosidase assay, but here fluorescence of luciferase gene product is used as the reporter. -	916

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
VCD_001716	VCD_001716	predicted transcriptional regulator